Review



synthetic sgrnas  (Synthego Inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Synthego Inc synthetic sgrnas
    Synthetic Sgrnas, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrnas/sgrnas+synthetic/pmc13253082-286-0-14
    Average 86 stars, based on 1 article reviews
    synthetic sgrnas - by Bioz Stars, 2026-09
    86/100 stars

    Images

    Related Articles

    Knock-Out:

    Article Title: SIRPα ablated iPSC-derived macrophages resist hypophagia and enhance mAb-dependent and CAR-mediated cytotoxicity of solid tumors
    Article Snippet: .. The SIRPA gene was targeted for knockout at exon 3 using two sgRNAs (Synthego), listed in . .. Singularized iPSCs (1 × 10 5 cells) were electroporated with 5 mg Cas9 protein (PNA Bio #CP02) and both sgRNAs (2.5 mg of each sgRNA) using Lonza Amaxa (Program B16) and Human Stem Cell Nucleofector Starter Kit (Lonza, VPH-5002).

    Synthesized:

    Article Title: TRIM5 integrates hypoglycemic stress and influenza infection.
    Article Snippet: .. Chemically synthesized sgRNAs (Synthego) targeting specific exonic regions of PRKAA1 (encoding AMPKα) and IFNAR1 were complexed with recombinant Cas9 protein (Integrated DNA Technologies) to form RNPs. sgRNA targeting sequences were 5′- TGAGAGCAGAGAATTTTTGTTTCCTGCAGTTTTTCTAGCTCCTAGCCTAGTACCTGGTATACT-3′ for AMPKa, and 5′-TCATTTACACCATTTCGCAA-3′ for IFNAR1. .. RNP complexes were delivered into A549 or MLE-12 cells via lipofection using Lipofectamine CRISPRMAX Cas9 reagent (Invitrogen, Carlsbad, CA).

    Recombinant:

    Article Title: TRIM5 integrates hypoglycemic stress and influenza infection.
    Article Snippet: .. Chemically synthesized sgRNAs (Synthego) targeting specific exonic regions of PRKAA1 (encoding AMPKα) and IFNAR1 were complexed with recombinant Cas9 protein (Integrated DNA Technologies) to form RNPs. sgRNA targeting sequences were 5′- TGAGAGCAGAGAATTTTTGTTTCCTGCAGTTTTTCTAGCTCCTAGCCTAGTACCTGGTATACT-3′ for AMPKa, and 5′-TCATTTACACCATTTCGCAA-3′ for IFNAR1. .. RNP complexes were delivered into A549 or MLE-12 cells via lipofection using Lipofectamine CRISPRMAX Cas9 reagent (Invitrogen, Carlsbad, CA).



    Similar Products

    sgrna  (Fasmac Co Ltd)
    86
    Fasmac Co Ltd sgrna
    Sgrna, supplied by Fasmac Co Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrnas/sgrna/pmc13123328-128-1-2
    Average 86 stars, based on 1 article reviews
    sgrna - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    sgrna  (Qidong Gaitianli Pharmaceutical Co)
    86
    Qidong Gaitianli Pharmaceutical Co sgrna
    Sgrna, supplied by Qidong Gaitianli Pharmaceutical Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrnas/sgrna/pmc09378680-789-11-18
    Average 86 stars, based on 1 article reviews
    sgrna - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    synthetic sgrnas  (Synthego Inc)
    86
    Synthego Inc synthetic sgrnas
    Synthetic Sgrnas, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrnas/sgrnas+synthetic/pmc13253082-286-0-14
    Average 86 stars, based on 1 article reviews
    synthetic sgrnas - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    sgrna design  (Benchling Inc)
    86
    Benchling Inc sgrna design
    Sgrna Design, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrnas/crispr+design+tool/pmc13052146-61-0-3
    Average 86 stars, based on 1 article reviews
    sgrna design - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    sgrnas  (Synthego Inc)
    86
    Synthego Inc sgrnas
    Sgrnas, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrnas/sgrnas/pmc13264185-223-12-13
    Average 86 stars, based on 1 article reviews
    sgrnas - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    single guide rna sgrna  (Synthego Inc)
    86
    Synthego Inc single guide rna sgrna
    Single Guide Rna Sgrna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrnas/sgrna/pmc13273111-269-6-22
    Average 86 stars, based on 1 article reviews
    single guide rna sgrna - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    sgrna  (Synthego Inc)
    86
    Synthego Inc sgrna
    Sgrna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrnas/sgrna/pm42310856-58-1-8
    Average 86 stars, based on 1 article reviews
    sgrna - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    synthetic single guide rnas sgrnas  (Synthego Inc)
    86
    Synthego Inc synthetic single guide rnas sgrnas
    Synthetic Single Guide Rnas Sgrnas, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrnas/guide+rnas/pm42304380-224-0-11
    Average 86 stars, based on 1 article reviews
    synthetic single guide rnas sgrnas - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    scaav sgrna gfp  (Addgene inc)
    92
    Addgene inc scaav sgrna gfp
    Scaav Sgrna Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrnas/scAAV+GFP+(Plasmid+%2321893)/pmc13022658-113-6-7
    Average 92 stars, based on 1 article reviews
    scaav sgrna gfp - by Bioz Stars, 2026-09
    92/100 stars
    		  Buy from Supplier
    sgrna sequences  (Sangon Biotech)
    86
    Sangon Biotech sgrna sequences
    Sgrna Sequences, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrnas/sequences+sirna/pm42296148-160-11-26
    Average 86 stars, based on 1 article reviews
    sgrna sequences - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier

    Image Search Results